REVIEW DNA/RNA PROTEIN SYNTHESIS 1010C            CLICK FOR GENETICS GLOSSARY

Chapter 16 & 17* Objectives

 

REVIEW DNA/RNA PROTEIN SYNTHESIS 1010C

1 What is the relationship among DNA, a gene, and a chromosome? A chromosome contains hundreds of genes which are composed of DNA.

2 Which of the following DNA mutations would have the greatest effect on a protein's structure? the deletion of a single pair of nucleotides

3 Where is the attachment site for RNA polymerase? promoter region

4 What is an anticodon part of? tRNA

5 The following are true? (A) Transcriptionally produced gene products are molecules of RNA. (B) Proteins are translated in the cytoplasm.(C) Steroid hormones may bind directly to DNA and regulate expression. (D)Histones are found only in eukaryotic chromosomes.

6 DNA has two functions: it can self-replicate and it can make non-DNA molecules. DNA is capable of these because its nucleotides will form base-pairs with both ribose and deoxyribose nucleotides.mes.

7 Once transcribed, eukaryotic hnRNA typically undergoes substantial alteration that includes excision of introns.

8 Which of the following is true for both prokaryotic and eukaryotic gene expression?. RNA polymerase may recognize a promoter region upstream from the gene.

9 A particular eukaryotic protein is 300 amino acids long. Which of the following could be the number of nucleotides in the DNA that codes for this protein? 1800

10 A particular triplet of bases in the coding sequence of DNA is AGT. What is the corresponding triplet in the complementary strand of DNA? TCA .

11 The corresponding codon for the mRNA transcribed from the gene is: UCA

12 The anticodon on the tRNA that binds this mRNA codon is AGU

13 Accuracy in the translation of mRNA into the primary structure of a protein depends on specificity in the bonding of the anticodon to the codon.and attachment of amino acids to tRNAs.

14 What are the coding segments of a stretch of DNA called? exons

15 All of the following are directly involved in translation EXCEPT DNA.

16 RNA differs from DNA in that RNA contains ribose as its sugarandcontains uracil instead of thymine.

17 When a ribosome first attaches to an mRNA molecule, one tRNA binds to the ribosome. The tRNA that recognizes the initiation codon binds to the peptide site (P site) of the ribosome only.

18 If proteins were composed of only 12 amino acids, what would be the smallest possible codon size in a genetic system with four different nucleotides? 2

19 From the following list, which is the first event in translation in eukaryotes? base-pairing of activated methionine-tRNA to AUG of the messenger

20 What type of bonding is responsible for maintaining the shape of the tRNA molecule? hydrogen bonding between base pairs

21 As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?. The transfer RNA that was in the A site moves into the P site . The tRNA that was in the P site departs from the ribosome.

22 A frameshift mutation could result from either an insertion or deletion of a base.

23 If the triplet UUU codes for the amino acid phenylalanine in bacteria, then in plants UUU should code for phenylalanine.

24 Which point mutation would be most likely to have a catastrophic effect on the functioning of a protein? a base deletion near the start of the coding sequence

25. List protein synthesis in theproper sequence.

26 Which of these statements represents a common misconception regarding point mutations? They always produce a change in the amino acid sequence of a protein.

27 A portion of the genetic code is UUU = phenylalanine, GCC = alanine, AAA = lysine, and CCC = proline. Assume the correct code places the amino acids phenylalanine, alanine, and lysine in a protein (in that order). Which of the following DNA sequences would substitute proline for alanine? AAAGGGTTT

28 The following DNA sequence shows a "gene" encoding a small peptide. The three "Stop" codons are UAA, UAG, and UGA.

promoter

5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3'

3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC 5'

How many amino acids long will the small protein encoded by this"gene" be? 4

29 What amino acid sequence will be generated, based on the following mRNA codon sequence? 5'-AUG-UCU-UCG-UUA-UCC-UUG . met-ser-ser-leu-ser-leu

30 A peptide has the sequence NH2-phe-pro-lys-gly-phe-pro-COOH. What is the sequence in DNA that codes for this peptide?

3' AAA GGG TTT CCC AAA GGG

31 What is the sequence of a peptide based on the mRNA sequence 5'UUUUCUUAUUGUCUU? phe-ser-tyr-cys-leu

32 Suppose the following DNA sequence was mutated from 3'-AGA GAG AGA GAG AGA GAG A...to 3'-AGA AGA GAG ATC GAG AGA. What amino acid sequence will be generated based on this mutated DNA? ser-ser-leu

33What are polysomes? . groups of ribosomes reading the same mRNA simultaneously C All of the following are found in prokaryotic messenger RNA EXCEPT (A) AUG codon. (B). UGA codon. (C) introns. (D) Uracil. (E) Cytosine.

34 The maximum number of different tRNAs possible in a cell is 61

35 The first event in translation of eukaryotes (starting with methionine) is the base pairing of met-tRNA to AUG of the messenger RNA. .

36 During translation, chain elongation continues until what happens? )Chain terminator codons occur.

37 Which of the following represents a similarity between RNA and DNA? ) nucleotides consisting of a phosphate, sugar and nitrogen base

38 What are ribosomes composed of?) both rRNA and protein

39 All of the following are transcribed from DNA exons. rRNA. tRNA. mRNA.

40 Where is ribosomal RNA transcribed? nucleoli

41 Sickle-cell anemia is probably the result of which kind of mutation? point

42 Which of the following does not occur during the termination phaseof translation? A tRNA with the next amino acid enters the P site.

43 Which of the following DNA mutations is the most potentially damaging to the protein it specifies? a base-pair deletion of DNA

44     What represents a similarity between RNA and DNA? P   and bases A, C G

45   DNA polymerase  

46. Okazaki fragments 

47.  28

48 TCA

49 Chain terminator codons occur  

50     a tRNA with the next amino acid enters the P site 

    51 UCA 

 

52.Refer to the list of enzymes to answer the following questions.

(B)      helicase  (B) exonuclease  (C) ligase  (D) polymerase (E) primase

 

d  catalyzes synthesis of a new strand of  DNA

a   enhances separation of DNA strands during replication

c  Covalently connects segments of DNA

e synthesizes short segments of RNA

d does most of the repair of damage to DNA

 

d a c e d

 

back to questions

 

<

 

Back To Menu                                                                                                 answers