REVIEW DNA/RNA PROTEIN SYNTHESIS 1010C
1 What is the relationship among DNA, a gene, and a chromosome? A chromosome contains hundreds of genes which are composed of DNA.
3 Where is the attachment site for RNA polymerase? promoter region
5 The following are true? (A) Transcriptionally produced gene products are molecules of RNA. (B) Proteins are translated in the cytoplasm.(C) Steroid hormones may bind directly to DNA and regulate expression. (D)Histones are found only in eukaryotic chromosomes.
7 Once transcribed, eukaryotic hnRNA typically undergoes substantial alteration that includes excision of introns.
9 A particular eukaryotic protein is 300 amino acids long. Which of the following could be the number of nucleotides in the DNA that codes for this protein? 1800
11 The corresponding codon for the mRNA transcribed from the gene is: UCA
13 Accuracy in the translation of mRNA into the primary structure of a protein depends on specificity in the bonding of the anticodon to the codon.and attachment of amino acids to tRNAs.
15 All of the following are directly involved in translation EXCEPT DNA.
17 When a ribosome first attaches to an mRNA molecule, one tRNA binds to the ribosome. The tRNA that recognizes the initiation codon binds to the peptide site (P site) of the ribosome only.
19 From the following list, which is the first event in translation in eukaryotes? base-pairing of activated methionine-tRNA to AUG of the messenger
21 As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?. The transfer RNA that was in the A site moves into the P site . The tRNA that was in the P site departs from the ribosome.
23 If the triplet UUU codes for the amino acid phenylalanine in bacteria, then in plants UUU should code for phenylalanine.
25. List protein synthesis in theproper sequence.
27 A portion of the genetic code is UUU = phenylalanine, GCC = alanine, AAA = lysine, and CCC = proline. Assume the correct code places the amino acids phenylalanine, alanine, and lysine in a protein (in that order). Which of the following DNA sequences would substitute proline for alanine? AAAGGGTTT
promoter
5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3'
3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC 5'
How many amino acids long will the small protein encoded by this"gene" be? 4
29 What amino acid sequence will be generated, based on the following mRNA codon sequence? 5'-AUG-UCU-UCG-UUA-UCC-UUG . met-ser-ser-leu-ser-leu
3' AAA GGG TTT CCC AAA GGG
31 What is the sequence of a peptide based on the mRNA sequence 5'UUUUCUUAUUGUCUU? phe-ser-tyr-cys-leu
33What are polysomes? . groups of ribosomes reading the same mRNA simultaneously C All of the following are found in prokaryotic messenger RNA EXCEPT (A) AUG codon. (B). UGA codon. (C) introns. (D) Uracil. (E) Cytosine.
35 The first event in translation of eukaryotes (starting with methionine) is the base pairing of met-tRNA to AUG of the messenger RNA. .
37 Which of the following represents a similarity between RNA and DNA? ) nucleotides consisting of a phosphate, sugar and nitrogen base
39 All of the following are transcribed from DNA exons. rRNA. tRNA. mRNA.
41 Sickle-cell anemia is probably the result of which kind of mutation? point
43 Which of the following DNA mutations is the most potentially damaging to the protein it specifies? a base-pair deletion of DNA
45
DNA polymerase
47. 28
49
Chain terminator codons occur
51 UCA
52.Refer
to the list of enzymes to answer the following questions.
(B)
helicase (B) exonuclease (C) ligase (D) polymerase (E) primase
d catalyzes synthesis of a new strand
of DNA
a enhances separation of DNA
strands during replication
c Covalently connects segments of DNA
e
synthesizes short segments of RNA
d
does most of the repair of damage to DNA
d a c e d
<