REVIEW DNA/RNA PROTEIN SYNTHESIS 1010C
2 Which of the following DNA mutations would have the greatest effect on a protein's structure? the deletion of a single pair of nucleotides
4 What is an anticodon part of? tRNA
6 DNA has two functions: it can self-replicate and it can make non-DNA molecules. DNA is capable of these because its nucleotides will form base-pairs with both ribose and deoxyribose nucleotides.mes.
8 Which of the following is true for both prokaryotic and eukaryotic gene expression?. RNA polymerase may recognize a promoter region upstream from the gene.
10 A particular triplet of bases in the coding sequence of DNA is AGT. What is the corresponding triplet in the complementary strand of DNA? TCA .
12 The anticodon on the tRNA that binds this mRNA codon is AGU
14 What are the coding segments of a stretch of DNA called? exons
16 RNA differs from DNA in that RNA contains ribose as its sugarandcontains uracil instead of thymine.
18 If proteins were composed of only 12 amino acids, what would be the smallest possible codon size in a genetic system with four different nucleotides? 2
20 What type of bonding is responsible for maintaining the shape of the tRNA molecule? hydrogen bonding between base pairs
22 A frameshift mutation could result from either an insertion or deletion of a base.
.
24 Which point mutation would be most likely to have a catastrophic effect on the functioning of a protein? a base deletion near the start of the coding sequence
26 Which of these statements represents a common misconception regarding point mutations? They always produce a change in the amino acid sequence of a protein.
28 The following DNA sequence shows a "gene" encoding a small peptide. The three "Stop" codons are UAA, UAG, and UGA.
promoter
5' (ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3'
3' (TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTC 5'
How many amino acids long will the small protein encoded by this"gene" be? 4
30 A peptide has the sequence NH2-phe-pro-lys-gly-phe-pro-COOH. What is the sequence in DNA that codes for this peptide?
3' AAA GGG TTT CCC AAA GGG
32 Suppose the following DNA sequence was mutated from 3'-AGA GAG AGA GAG AGA GAG A...to 3'-AGA AGA GAG ATC GAG AGA. What amino acid sequence will be generated based on this mutated DNA? ser-ser-leu
34 The maximum number of different tRNAs possible in a cell is 61
36 During translation, chain elongation continues until what happens? )Chain terminator codons occur.
38 What are ribosomes composed of?) both rRNA and protein
40 Where is ribosomal RNA transcribed? nucleoli
42 Which of the following does not occur during the termination phaseof translation? A tRNA with the next amino acid enters the P site.
44 What represents a similarity between RNA and DNA? P and bases A, C G
46.
Okazaki fragments
48
TCA
50
a tRNA with the next amino acid enters the P site
52.Refer
to the list of enzymes to answer the following questions.
(B)
helicase (B) exonuclease (C) ligase (D) polymerase (E) primase
d catalyzes synthesis of a new strand
of DNA
a enhances separation of DNA
strands during replication
c
Covalently connects segments of DNA
e
synthesizes short segments of RNA
d
does most of the repair of damage to DNA
d a c e d
<